Quality control is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Last reviewed on 2026-07-10. Where a claim depends on a specific study, the study is described rather than over-claimed.
In cells, glutathione exists mainly in a reduced form called GSH. When two GSH molecules react, they form oxidized glutathione, or GSSG, which contains a disulfide bond. The ratio of GSH to GSSG is often used as an indicator of oxidative stress. Enzymes such as glutathione peroxidase and glutathione reductase help cycle the molecule between these two states. This cycling supports antioxidant defense, detoxification of reactive molecules, and regulation of certain signaling pathways.
Glutathione is present in most tissues, with especially high concentrations in the liver. It also serves as a cofactor for some enzymes and helps transport amino acids across cell membranes. In plants and microorganisms, glutathione contributes to stress responses and metal handling. The molecule is synthesized in two ATP-dependent steps, first producing gamma-glutamylcysteine and then adding glycine. Because cysteine availability often limits synthesis, dietary and metabolic factors can influence glutathione levels. Research continues to examine how these levels relate to health and disease.
Glutathione is a tripeptide composed of glutamate, cysteine, and glycine. The peptide bond between glutamate and cysteine uses the gamma-carboxyl group of glutamate rather than the alpha-carboxyl group. This unusual linkage protects the molecule from many common peptidases. The cysteine side chain carries a thiol group that can undergo reversible oxidation. Because of this thiol, glutathione participates in redox reactions and helps maintain the reducing environment inside most cells in living systems.
Quality control for glutathione materials checks identity, assay, purity, water content, and disulfide content. Commercial products vary from research-grade powder to dietary supplements, and labels may not distinguish reduced from oxidized forms. In the United States, oral glutathione is commonly sold as a dietary supplement rather than an approved drug, while injectable forms fall under different rules and may require a prescription. Regulatory status differs by country. Analytical certificates, when available, help verify what a material contains, but independent testing remains important for interpretation.
Laboratory measurement of glutathione typically starts with rapid acid extraction to prevent oxidation and enzymatic degradation. Common methods include enzymatic recycling assays, high-performance liquid chromatography, and liquid chromatography coupled with mass spectrometry. The recycling assay uses glutathione reductase and a thiol-reactive colorimetric or fluorescent reagent, measuring total glutathione after converting disulfide forms. Chromatographic methods can separate reduced and oxidized forms, which helps when the redox ratio is the target. Choice of method affects sensitivity, specificity, and the amount of sample needed.
Samples for glutathione analysis require careful handling because the compound oxidizes readily and can be consumed by enzymes after collection. Blood is often treated with acid or thiol-blocking agents soon after draw, and plasma should be separated quickly from red blood cells. Tissues are usually snap-frozen or extracted immediately. Aqueous solutions of glutathione are less stable than dry powder and degrade faster at neutral or alkaline pH, in light, or with dissolved oxygen. Repeated freeze-thaw cycles also reduce reliability.
| Property | Value | Notes |
|---|---|---|
| Common name | Glutathione | Tripeptide of glutamate, cysteine, and glycine |
| Reduced form | GSH | Dominant intracellular thiol |
| Oxidized form | GSSG | Disulfide-linked dimer |
| Molar mass | 307.32 g/mol | For reduced glutathione |
| Functional motif | Gamma-glutamyl-cysteinyl-glycine | Gamma linkage resists many peptidases |
Biosynthesis occurs in two ATP-dependent steps. The enzyme glutamate-cysteine ligase joins glutamate and cysteine, forming gamma-glutamylcysteine; glutathione synthetase then adds glycine to produce the complete tripeptide. Because the peptide bond from glutamate uses the gamma-carboxyl group, glutathione resists digestion by many ordinary peptidases. Tissues vary in synthesis capacity, and the liver generally contains high concentrations relative to many other organs. This uneven distribution contributes to organ-specific differences in redox buffering and affects how experimental results are interpreted across tissue types.
Glutathione participates in detoxification reactions, amino acid transport, and the maintenance of protein thiols. It serves as a cofactor for several enzymes, including glutathione peroxidases and glutathione S-transferases. In research literature, altered glutathione status appears in studies of aging, infection, metabolic stress, and environmental exposure. Whether low glutathione is a cause, consequence, or marker of such conditions often remains unresolved. Direct measurement in blood or tissue provides a snapshot, but results depend on sample handling, timing, and the method used.
Stability depends on pH, temperature, oxygen exposure, and trace metals. Aqueous solutions of reduced glutathione are susceptible to oxidation, especially when neutral or alkaline and exposed to air. Transition metal ions can catalyze thiol oxidation, so chelators and inert atmospheres are sometimes used in research settings. Standards are typically stored cold and desiccated, with limited freeze-thaw cycles. Questions remain about how closely in vitro stability data reflect the behavior of glutathione within intact cells and tissues.
Measuring glutathione requires attention to oxidation during sample handling, because GSH in biological samples can convert to GSSG or form mixed disulfides with proteins after collection. Acidic extraction, rapid cooling, and chelating agents are commonly used to limit such changes. Analytical methods usually distinguish free reduced glutathione, total glutathione, and protein-bound forms. Because these forms have different stability and reactivity, reported values depend heavily on the preparation protocol. No single preparation is universally suitable for every biological matrix or analytical goal.
Romanowsky's research for his medical degree in 1880s was mainly on the identification of malarial parasite (Plasmodium). Until that time malarial infection was difficult to confirm as the parasites were hard to distinguish from blood cells or cell organelles. Pigmented blood cells were often linked to malarial infection, but the pigments are not always visible. When French physician Charles Louis Alphonse Laveran discovered and described the malarial protozoan (later called Plasmodium falciparum) in 1880, it was not accepted as no protozoan had ever been seen in blood cells or associated with malaria. In 1871, German chemist Adolf von Baeyer synthesised a red dye called eosin (Greek word for "morning red"), which in 1876 was found to be useful for staining tissues. Another German chemist Heinrich Caro synthesised a blue dye named methylene blue in 1876, which was first used as a cell stain by Robert Koch. In 1882, using methylene blue Koch discovered the causative bacterium of tuberculosis, tubercle bacillus (now Mycobacterium tuberculosis). The two stains remain among the fundamental stains used in general cell and tissue staining, as well as in clinical diagnosis.
22. Adv Gerontol. 2010;23(4):543-6. [Influence of peptides from pineal gland on thymus function at aging]. [Article in Russian] Lin'kova NS, Poliakova VO, Trofimov AV, Sevost'ianova NN, Kvetnoĭ IM. The interference between thymus and pineal gland during their involution is considered in this review. The research data about influence of thymus peptides on pineal gland and pineal peptides on thymus is summarized. Analysis of these data showed that pineal peptides (epithalamin, epitalon) had more effective geroprotective effect on thymus involution in comparison with geroprotective effect of thymic peptides (thymalin, thymogen) on involution of pineal gland. The key mechanisms of pineal peptides effect on thymus dystrophy is immunoendocrine cooperation, which is realized as transcription's activation of various proteins.
In PET imaging, [18F]FDG is primarily used for imaging tumors in oncology, where a static [18F]FDG PET scan is performed and the tumor [18F]FDG uptake is analyzed in terms of Standardized Uptake Value (SUV). FDG PET/CT can be used for the assessment of glucose metabolism in the heart and the brain. [18F]FDG is taken up by cells, and subsequently phosphorylated by hexokinase (whose mitochondrial form is greatly elevated in rapidly growing malignant tumours). Phosphorylated [18F]FDG cannot be further metabolised and is thus retained by tissues with high metabolic activity, such as most types of malignant tumours. As a result, FDG-PET can be used for diagnosis, staging, and monitoring treatment of cancers, particularly in Hodgkin's disease, non-Hodgkin lymphoma, colorectal cancer, breast cancer, melanoma, and lung cancer. It has also been approved for use in diagnosing Alzheimer's disease. In body-scanning applications in searching for tumor or metastatic disease, a dose of [18F]-FDG in solution (typically 5 to 10 millicuries or 200 to 400 MBq) is typically injected rapidly into a saline drip running into a vein, in a patient who has been fasting for at least six hours, and who has a suitably low blood sugar. (This is a problem for some diabetics; usually PET scanning centers will not administer the isotope to patients with blood glucose levels over about 180 mg/dL = 10 mmol/L, and such patients must be rescheduled).
Psychiatric diagnoses take place in a wide variety of settings and are performed by many different health professionals. Therefore, the diagnostic procedure may vary greatly based upon these factors. Typically, though, a psychiatric diagnosis utilizes a differential diagnosis procedure where a mental status examination and physical examination is conducted, with pathological, psychopathological or psychosocial histories obtained, and sometimes neuroimages or other neurophysiological measurements are taken, or personality tests or cognitive tests administered. In some cases, a brain scan might be used to rule out other medical illnesses, but at this time relying on brain scans alone cannot accurately diagnose a mental illness or tell the risk of getting a mental illness in the future. Some clinicians are beginning to utilize genetics and automated speech assessment during the diagnostic process but on the whole these remain research topics.
Peña suspended negotiations with Brazil on the revision of Annex C of the Itaipu Treaty, alleging a supposed case of digital espionage by Brazilian authorities between 2022 and 2023. Critical sectors pointed out that the suspension favored Brazil by keeping frozen a key process to correct what they consider a historic disadvantage for Paraguay in the distribution of the benefits of hydroelectricity generated by Itaipu Binacional.
Sources: en.wikipedia.org
Many pharmaceuticals are derived from petroleum, albeit via multi-step processes. Modern medicine depends on petroleum as a source of building blocks, reagents, and solvents. Similarly, virtually all pesticides, insecticides, and herbicides are derived from petroleum. Pesticides have profoundly affected life expectancies by controlling disease vectors and by increasing crop yield. Like pharmaceuticals, pesticides are in essence petrochemicals. Almost all plastics and synthetic polymers are derived from petroleum, which is the source of monomers. Alkenes (olefins) are one important class of these precursor molecules.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
==== Distribution ==== Spironolactone and its metabolite canrenone are highly plasma protein bound, with percentages of 88.0% and 99.2%, respectively. Spironolactone is bound equivalently to albumin and α1-acid glycoprotein, while canrenone is bound only to albumin. Spironolactone and its metabolite 7α-thiospironolactone show very low or negligible affinity for sex hormone-binding globulin (SHBG). In accordance, a study of high-dosage spironolactone treatment found no change in steroid binding capacity related to SHBG or to corticosteroid-binding globulin (CBG), suggesting that spironolactone does not displace steroid hormones from their carrier proteins. This is in contradiction with widespread statements that spironolactone increases free estradiol levels by displacing estradiol from SHBG. Spironolactone appears to cross the blood–brain barrier.
Ukrainian President Volodymyr Zelenskyy claimed that air defences had shot down some thirty six Shahed drones. In occupied Crimea, the regional governor said six Ukrainian drones were shot down. In an interview with Die Welt, Vadym Skibitsky, deputy head of Ukraine's military intelligence service, said the government intends to assassinate Putin "because he coordinates and decides what happens" in the war. Yevgeny Prigozhin announced the start of the turnover of Bakhmut from his Wagner mercenaries to the Russian military and his forces' withdrawal from the city. He also said they would repatriate the bodies of an American national, whom he identified as a former special forces soldier named Nicholas Maimer, and a Turkish citizen, which they claimed to have recovered from the remains of a building blown up by Ukrainian forces, adding that the body of another Turkish national, a woman, was also found but could not be retrieved. 106 Ukrainian POWs captured in Bakhmut were repatriated to Ukraine in a prisoner exchange with Russia. The FSB announced that it had arrested two members of a Ukrainian "sabotage group" and two Russian accomplices who were plotting to bomb power lines connected to the Leningrad and Kalinin Nuclear Power Plants, adding that 36.5 kilos of explosives and about 60 detonators were recovered from them. The Russian Defence Ministry said it had scrambled Su-27 and Su-35 fighter jets to intercept two US Air Force B-1B strategic bombers near the country's airspace boundary over the Baltic Sea.
Sources: en.wikipedia.org
== Secondary structure == Because their backbones are longer than those of normal peptides, β-peptides form disparate secondary structures. The alkyl substituents at both the α and β positions in a β-amino acid favor a gauche conformation about the bond between the α-carbon and β-carbon. This also affects the thermodynamic stability of the structure. Many types of helix structures consisting of β-peptides have been reported. These conformation types are distinguished by the number of atoms in the hydrogen-bonded ring that is formed in solution; 8-helix, 10-helix, 12-helix, 14-helix, and 10/12-helix have been reported. Generally speaking, β-peptides form a more stable helix than α-peptides.
The process continued until 1817, when Sertürner published his results after thirteen years of research and a nearly disastrous trial on himself and three boys. The great advantage of purified morphine was that a patient could be treated with a known dose—whereas with raw plant material, as Gabriel Fallopius once lamented: "if soporifics are weak they do not help; if they are strong they are exceedingly dangerous". Morphine was the first pharmaceutical isolated from a natural product, and this success encouraged the isolation of other alkaloids: by 1820, isolations of noscapine, strychnine, veratrine, colchicine, caffeine, and quinine were reported. Morphine sales began in 1827, by Heinrich Emanuel Merck of Darmstadt, and helped him expand his family pharmacy into the Merck KGaA pharmaceutical company. Codeine was isolated in 1832 by Pierre Jean Robiquet. The use of diethyl ether and chloroform for general anesthesia began in 1846–1847, and rapidly displaced the use of opiates and tropane alkaloids from Solanaceae due to their relative safety. Heroin, the first semi-synthetic opioid, was first synthesized in 1874, but was not pursued until its rediscovery in 1897 by Felix Hoffmann at the Bayer pharmaceutical company in Elberfeld, Germany. From 1898 to 1910 heroin was marketed as a non-addictive morphine substitute and cough medicine for children. Because the lethal dose of heroin was viewed as a hundred times greater than its effective dose, heroin was advertised as a safer alternative to other opioids.
== Further reading == Iwata TN, Sugihara K, Wada T, Agatsuma T (October 2019). "[Fam-] trastuzumab deruxtecan (DS-8201a)-induced antitumor immunity is facilitated by the anti-CTLA-4 antibody in a mouse model". PLOS ONE. 14 (10) e0222280. Bibcode:2019PLoSO..1422280I. doi:10.1371/journal.pone.0222280. PMC 6772042. PMID 31574081.{{cite journal}}: CS1 maint: overridden setting (link) Modi S, Saura C, Yamashita T, Park YH, Kim SB, Tamura K, et al. (February 2020). "Trastuzumab Deruxtecan in Previously Treated HER2-Positive Breast Cancer". N. Engl. J. Med. 382 (7): 610–621. doi:10.1056/NEJMoa1914510. PMC 7458671. PMID 31825192.{{cite journal}}: CS1 maint: overridden setting (link)
==== Insects ==== Serotonin is evolutionarily conserved and appears across the animal kingdom. It is seen in insect processes in roles similar to in the human central nervous system, such as memory, appetite, sleep, and behavior. Some circuits in mushroom bodies are serotonergic. (See specific Drosophila example below, §Dipterans.)
=== Ecology === Naegleria fowleri, an excavate, inhabits soil and water. It is sensitive to drying and acidic conditions, and cannot survive in seawater. The amoeba thrives at moderately elevated temperatures, making infections more likely during the summer months. N. fowleri is a facultative thermophile, capable of growing at temperatures up to 46 °C (115 °F). Warm, fresh water with an ample supply of bacteria as food provides a suitable habitat for amoebae. Locations where many amoebic infections have occurred include artificial bodies of water, disturbed natural habitats, areas with soil, and unchlorinated or unfiltered water. N. fowleri appears to flourish during periods of disturbance. The "flagellate-empty" hypothesis suggests that N. fowleri's success may stem from decreased competition when thermosensitive protozoal fauna do not survive temperature changes. In other words, N. fowleri thrives when other predators consuming its food supply are absent. This hypothesis implies that human disturbances, such as thermal pollution, increase the abundance of N. fowleri by eliminating its resource competitors. Amoeboflagellates have a motile, flagellated stage that aids in dispersal, which is advantageous in environments cleared of competing organisms.
Sources: en.wikipedia.org
Glutathione is a tripeptide made from glutamate, cysteine, and glycine. Its cysteine residue provides a thiol group that is central to its redox activity. The glutamate-cysteine bond forms through the gamma-carboxyl group of glutamate.
Reduced glutathione, GSH, can donate electrons and become oxidized to GSSG. The balance between these forms reflects the cell's redox environment. A shift toward GSSG is commonly interpreted as evidence of oxidative stress, though the ratio can vary by tissue and method.
Glutathione occurs in nearly all cell types, with notable amounts in the liver. It is also present in the lungs, kidneys, and red blood cells. Concentrations differ among tissues and change with age, diet, and disease states.
Common approaches include enzymatic recycling assays, HPLC, and LC-MS/MS. Acid extraction and rapid processing limit oxidation before analysis.